Roger's Equations Blog

Roger's Equations

This blog is all about science and technology (with occasional math thrown in for fun). The goal of this blog is to try and pass on the sense of excitement and wonder I feel when I read about these topics. I hope you enjoy the posts.

Previous in Blog: The Chemistry of DNA, Part 3   Next in Blog: The Antiscience - Part I
Close
Close
Close
17 comments
Rate Comments: Nested

The Chemistry of DNA Part 4

Posted December 22, 2009 3:00 PM by Bayes

This is the fourth and final post in a series detailing the chemistry of DNA. In the previous post, I described how the human body mostly consists of proteins and water. I then described how proteins generally are crosslinked peptides, which are themselves made up of chained together (through peptide bonds) amino acids. In posts one and two of this series I described the chemical structure of DNA, explained what a gene and chromosome is, and showed how the size of DNA can vary from species to species. Now I want to tie it all together and explain DNA's role in the creation of proteins in the human body.

Simply put, proteins are the point of DNA. I've mentioned several times earlier that proteins are simply strings of amino acids. Each protein has a different combination (order) of amino acids that give it it's properties. That order, the order of the amino acids in the proteins, is encoded in DNA. DNA is a repository where all the amino acid sequences needed to make the proteins that make us human are stored. DNA knows how to make the proteins, the proteins make us.

DNA Code

DNA is a list of proteins encoded with nucleobases. Remember, in the earlier posts I told you that DNA consisted of two intertwined polymers with phosphate/sugar backbones that crosslinked with each other in a double helix pattern through pairs of complementary nucleobases. Those complementary nucleobases are Cystosine and Guanine, Thymine and Adenine. Those pairs appear like steps on a spiral staircase. Generally you read the nucleobases from one of the strands and you get the code. It will appear something like this:

GGGCTAAATGTATATTTTTAA

The G,C,T,A stand for Guanine, Cytosine, Thymine, and Adenine respectively.

In cells, that code above is transcribed by mRNA (Messenger RNA) by numerous processes to create Proteins.

Notice in the diagram to the right that the transcripted DNA code is read in threes. Each set of three nucleobases (called codons) represents a particular amino acid (represented by shapes). Those amino acids are put together to form the protein encoded by the DNA code. Now the diagram to the right is an incredible oversimplification, there are thousands of proteins and chemicals involved in this process, later in the blog we'll get into it a little bit more, but first.....

You may have noticed, or will notice soon, that RNA doesn't have the nucleobase Thymine. It instead has Uracil. The two bases are very similiar (see below):

So Uracil takes the place of Thymine when mRNA transcribes the DNA codon. Actually, if we are completely accurate here, the mRNA is actually a negative of the DNA code. For instance, if the DNA code is the following:

GGGCTAAATGTATATTTTTAA

where G,C,T,A are Guanine, Cytosine, Thymine, and Adanine respectively, then the transcribed mRNA sequence corresponding to the above would be:

CCCGAUUUACAUAUAAAAAUU

The mRNA sequence above is the complementary base pair sequence of the original DNA sequence, except Uracil is now the complimentary base pair of Adanine rather than Thymine. The mRNA is like the negative of a photograph, the inverse of the DNA sequence.

RNA to Amino Acid Decoding Table

We all know that for any good code you need a decoder ring. So here is you're super codon to amino acid decoder table (see below):

You can see in the above table that all 20 amino acids have at least one codon associated with them. Some have several, it's not a one to one relation, there are degeneracies. When mRNA transcribes DNA, it carries the codon information with it. The stop listed above in the table is the sequence of code that says the protein is completed.

DNA, mRNA, tRNA (oh my!)

So how does it happen? How does DNA code get turned into proteins? Well, a lot is involved, but the major players are DNA, messenger RNA (mRNA), and transfer RNA (tRNA). Here's a rough explanation of how it happens.

Step 1 - DNA and mRNA (Transcription)

As you know, DNA is two strands held together by nucleobase hydrogen bonds (see part one). Well the very first step is the breaking of these hydrogen bonds in a certain section of the DNA. Which section? That's complicated. Lets just say the section to be transcribed (or you can find an overview here). When these hydrogen bonds break, the a complementary messenger RNA (mRNA) strand is generated from the exposed single strand DNA in a process called transcription (see below):

Once the mRNA has been transcribed and processed a bit (overview here), it moves out of the cell nucleus (where the DNA is) and to a ribosome and begins the translation process.

Step 2 - mRNA, Ribosomes, tRNA (Translation)

Here's a few diagrams of the translation process:

There are many proteins and molecules involved in this process and the diagrams above are just the basics. Basically something called Transfer RNA (tRNA) attaches to the codons in mRNA. The tRNA has a portion called the "anticodon" which consists of the complimentary base pairs that correspond to a three nucleobase sequence (codon) of the mRNA sequence. A characteristic amino acid is attached to the other end of the tRNA. I say characteristic because the amino acid attached to that tRNA depends on the anticodon sequence on the other side. This is why the codons from mRNA control the order by which amino acids are put together.

Step 3 - Repeat

Cells are constantly generating proteins at different locations at all times. In a very basic sense, it's what it means to be alive. At this point I recommend watching from minute 2:51 till minute 6:54 in the following Youtube clip on DNA Translation and Transcription, it summarizes and expands many topics I discussed in this 4 part blog series.

So what does it all mean?

The Earth is 4.57 billion years old. The earliest evidence of life is debated but is somewhere in the range of 3.6 to 4.0 billion years ago. The truth is, it probably started before that (it's just hard to find the evidence). From a geological standpoint, life appeared shortly after the Earth did. What that means is if you have the conditions you have on Earth, life is likely. Evidence of multicellular life first appears 500 to 800 million years ago, meaning that it took roughly 3 billion years of cellular evolution to reach the point where multicellularism became possible. In less than a billion years we've evolved into complex organisms involving trillions of cells.

We all marvel at the complexity of our bodies. Hearts, brains, lungs, etc. working in unison seem miracles, and for some this is the only explanation. But wondering at such things is like reading the last chapter of a good novel. Most of the plot, most of the story is found in the processes found in our cells. Cells are unbelieveably complicated organic machines, streamlined over billions of years through fortuitous accidents. In the story of evolution, the protagonist is the cell. Multicelled organisms like ourselves are simply the most recent developement in the evolution of cellular symbiosis processess that evolved over eons.

So cells are the organic machines that is life, but they never could have evolved to such complexity if there wasn't a central molecule from which all the cell's processes ultimately are recorded, transcribed and translated. DNA does this astonishingly well. In a way, life can be viewed as a runaway chemical reaction. Soon after the Earth was born, the process of life started, and Earth has been stuck with life ever since (despite some truly respectable efforts to eradicate it). What DNA is, in the final evaluation, in my opinion, is an extremely robust catalyst that enables life.

Special Thanks to the Following Websites:

www.wikipedia.com
www.youtube.com
http://publications.nigms.nih.gov/thenewgenetics/chapter1.html
http://www.bio.miami.edu/~cmallery/150/gene/mol_gen.htm

Reply

Interested in this topic? By joining CR4 you can "subscribe" to
this discussion and receive notification when new comments are added.
Power-User
Engineering Fields - Mechanical Engineering - BSME Clarkson University 1992 Engineering Fields - Software Engineering - BSME Clarkson University 1992 Fans of Old Computers - TRS-80 - DataRock 1.0

Join Date: Apr 2008
Location: Troy, NY
Posts: 388
Good Answers: 3
#1

Re: The Chemistry of DNA Part 4

12/22/2009 4:31 PM

Nice blog piece on DNA, Roger. Many thanks for sharing your work here in CR4.

Connected to what you wrote, within the past few years I saw a documentary that expressed the theory that material from outer space - on asteroids, comets and the like that struck the young earth - may have contributed to the DNA stew that brewing when our planet was young. I think ancient bacteria from Martian volcanoes was one element of that possible material. I wonder if anyone has been able to confirm this in the laboratory yet?

I'm getting one of Richard Dawkins' early evolutionary biology books for Christmas, and so your blog connects nicely to what Santa is bringing me. :)

Happy Holidays to you, and to all my friends here in the CR4 Community!

Sincerely,

- Larry

Reply
Guru
Engineering Fields - Aerospace Engineering - Retired South Africa - Member - The Rainbow-nation Engineering Fields - Engineering Physics - Relativity & Cosmology Popular Science - Cosmology - The Big Picture!

Join Date: May 2006
Location: Pretoria, South Africa
Posts: 3804
Good Answers: 69
#3
In reply to #1

Re: The Chemistry of DNA Part 4

12/22/2009 11:31 PM

Hi Larry, you wrote: "I saw a documentary that expressed the theory that material from outer space - on asteroids, comets and the like that struck the young earth - may have contributed to the DNA stew that brewing when our planet was young."

AFAIK, there are good clues that 'prebiotic' molecules existed in the vast molecular clouds of interstellar space, but that they have not found evidence of 'biotic' amino acids (yet). They are most likely there, but it is probably just too difficult to detect them at the moment. So it is quite possible that comets could have brought the building blocks of life to Earth in some other other form.

I'm not convinced that the Martian meteorite (ALH 84001) contained microscopic fossils of Martian origin, but the debate is continuing...

-J

__________________
"Perplexity is the beginning of knowledge." -- Kahlil Gibran
Reply
Power-User
Engineering Fields - Mechanical Engineering - BSME Clarkson University 1992 Engineering Fields - Software Engineering - BSME Clarkson University 1992 Fans of Old Computers - TRS-80 - DataRock 1.0

Join Date: Apr 2008
Location: Troy, NY
Posts: 388
Good Answers: 3
#7
In reply to #3

Re: The Chemistry of DNA Part 4

12/23/2009 9:10 AM

Many thanks Jorrie & Roger for your comments. The science of tracing DNA origins is fascinating to me. I was a big fan of Spencer Well's series on U.S. cable's National Geographic channel, tracing the migrations of man via DNA sampling. Definitely will continue to follow this topic. - Larry

Reply
The Engineer
Engineering Fields - Engineering Physics - Physics... United States - Member - NY Popular Science - Genetics - Organic Chemistry... Popular Science - Cosmology - New Member Ingeniería en Español - Nuevo Miembro - New Member

Join Date: Feb 2005
Location: Albany, New York
Posts: 5060
Good Answers: 129
#9
In reply to #7

Re: The Chemistry of DNA Part 4

12/23/2009 9:20 AM

Yes, I enjoyed that show too.

Reply Off Topic (Score 5)
The Engineer
Engineering Fields - Engineering Physics - Physics... United States - Member - NY Popular Science - Genetics - Organic Chemistry... Popular Science - Cosmology - New Member Ingeniería en Español - Nuevo Miembro - New Member

Join Date: Feb 2005
Location: Albany, New York
Posts: 5060
Good Answers: 129
#4
In reply to #1

Re: The Chemistry of DNA Part 4

12/23/2009 8:47 AM

Hi Larry,

Thanks for the nice review of the blog. With regards to life originating outside of Earth, that is unlikely, since the vacuum of space, radiation of space, cold of space, and the heat of entry would most likely destroy any such life. I think Jorrie said it well, the precursors of life could have come from asteroid impacts, but probably not life itself. I too am unconvinced that the mars rock shows life from mars. The most likely explanations I've heard is the microbes penetrated the rock after it had impacted Earth.

The truth is that life probably has a much less exotic beginning. A bunch of precursors in marsh or puddle where evaporation could force them into a concentrated brew, then chemistry took care of the rest. A nice rainstorm washes the primitive life from it's puddle out to sea and the runaway chemistry experiment begins.

Roger

Reply
Guru
Engineering Fields - Aerospace Engineering - Retired South Africa - Member - The Rainbow-nation Engineering Fields - Engineering Physics - Relativity & Cosmology Popular Science - Cosmology - The Big Picture!

Join Date: May 2006
Location: Pretoria, South Africa
Posts: 3804
Good Answers: 69
#2

Re: The Chemistry of DNA Part 4

12/22/2009 11:03 PM

Hi Roger. Great mini-series. :)

Happy festive season!

-J

__________________
"Perplexity is the beginning of knowledge." -- Kahlil Gibran
Reply
The Engineer
Engineering Fields - Engineering Physics - Physics... United States - Member - NY Popular Science - Genetics - Organic Chemistry... Popular Science - Cosmology - New Member Ingeniería en Español - Nuevo Miembro - New Member

Join Date: Feb 2005
Location: Albany, New York
Posts: 5060
Good Answers: 129
#5
In reply to #2

Re: The Chemistry of DNA Part 4

12/23/2009 8:47 AM

Thanks Jorrie,

Happy Holidays to you as well!

Roger

Reply
Guru
Popular Science - Evolution - New Member Popular Science - Weaponology - New Member

Join Date: May 2006
Location: The 'Space Coast', USA
Posts: 11119
Good Answers: 918
#6

Re: The Chemistry of DNA Part 4

12/23/2009 9:09 AM

Outstanding work, Roger. Thanks for the series, you did an excellent job.

On a side track... One note that was drilled into my premed studies was that the tertiary shape of the protein is really the key to its function. The amino acid combination is important in that it helps define the shape (through hydrogen bonding), but the resulting protein shape is what makes a protein functional.

You can denature a protein (unfold or break its hydrogen bonds) by heat, salt concentration, pH, or chemically and render the protein dysfunctional, even though the amino acid order is unchanged.

You can also block a protein by adding a molecule to it. This inhibits its ability to bind to various protein receptors on the cell membrane. Aspirin is one such molecule.

Denaturing a protein can be done by heat and one trick next time you get the flu or a virus is to take a bath as hot as you can stand it for as long as you can stand it. This will denature some of the proteins of the virus in the peripheral arteries and help your immune system cope with the remaining virus.

Reply
The Engineer
Engineering Fields - Engineering Physics - Physics... United States - Member - NY Popular Science - Genetics - Organic Chemistry... Popular Science - Cosmology - New Member Ingeniería en Español - Nuevo Miembro - New Member

Join Date: Feb 2005
Location: Albany, New York
Posts: 5060
Good Answers: 129
#8
In reply to #6

Re: The Chemistry of DNA Part 4

12/23/2009 9:20 AM

Hi AH,

Yes, what you are saying is correct. The shape of the protein, which is indeed determined by the order of the amino acids making it, plays a significant role in its function. As you've noted, the environment that the protein exists in, such as the pH of the surrounding fluid or temperature, can strongly influence how it shapes as well, and thus it's function. We should keep in mind though that the chemistry of the amino acids matter as well. The chemistry, shape and environment together are what ultimately determines a proteins function. Hope that makes sense.

Roger

Reply
The Engineer
Engineering Fields - Engineering Physics - Physics... United States - Member - NY Popular Science - Genetics - Organic Chemistry... Popular Science - Cosmology - New Member Ingeniería en Español - Nuevo Miembro - New Member

Join Date: Feb 2005
Location: Albany, New York
Posts: 5060
Good Answers: 129
#10
In reply to #6

Re: The Chemistry of DNA Part 4

12/23/2009 9:44 AM

You Wrote:"Denaturing a protein can be done by heat and one trick next time you get the flu or a virus is to take a bath as hot as you can stand it for as long as you can stand it. This will denature some of the proteins of the virus in the peripheral arteries and help your immune system cope with the remaining virus."

This is in fact why we get fevers when we get sick. A fever is our bodies attempt to kill off foreign and harmful organisms by raising the temperature a little bit.

Reply
Guru
Popular Science - Evolution - New Member Popular Science - Weaponology - New Member

Join Date: May 2006
Location: The 'Space Coast', USA
Posts: 11119
Good Answers: 918
#13
In reply to #10

Re: The Chemistry of DNA Part 4

12/23/2009 10:53 AM

Good point, Roger.

Have a Merry Christmas and thanks again for the excellent blog.

Reply
Power-User

Join Date: Jul 2008
Location: Ontario, Canada
Posts: 203
Good Answers: 6
#11

Re: The Chemistry of DNA Part 4

12/23/2009 10:08 AM

Hello Roger,

Since DNA is a required central molecule to arrive at such complexity, when and how do you think DNA appeared on the scene? It seems the idea postured is that the chemistry within a cell controls the workings of that cell, yet the information part does not exist in those molecules, which leads back to the original question.

__________________
Faith is not blind, it is supremely reasonable.
Reply
The Engineer
Engineering Fields - Engineering Physics - Physics... United States - Member - NY Popular Science - Genetics - Organic Chemistry... Popular Science - Cosmology - New Member Ingeniería en Español - Nuevo Miembro - New Member

Join Date: Feb 2005
Location: Albany, New York
Posts: 5060
Good Answers: 129
#12
In reply to #11

Re: The Chemistry of DNA Part 4

12/23/2009 10:46 AM

Hi TF,

I only have an opinion, there is no scientific consensus on this as far as I know, but it is probable that life didn't originally have DNA. As you've seen in this series, it's the mRNA and the tRNA that do the work creating proteins. I imagine that the earliest life was RNA based and DNA evolved as a secure means of preserving the RNA sequence. It takes only a few small modifications to turn single strand RNA to single strand DNA. The DNA double helix is a strong storehouse, it makes sense that natural selection would immediately favor it over RNA only life.

Some viruses have no DNA, their gene's are RNA based, so the idea of RNA based life isn't far fetched.

Roger

Reply
Guru
Hobbies - Fishing -

Join Date: Feb 2009
Location: Burnt Ranch, State of Jefferson
Posts: 688
Good Answers: 20
#14

Re: The Chemistry of DNA Part 4

12/23/2009 10:58 AM

I'm sure this is incomplete, but it was a great visual.

Molecular Visualizations of DNA

http://www.youtube.com/watch?v=4PKjF7OumYo

__________________
“Sometimes I wonder whether the world is being run by smart people who are putting us on or by imbeciles who really mean it.” -Mark Twain
Reply
The Engineer
Engineering Fields - Engineering Physics - Physics... United States - Member - NY Popular Science - Genetics - Organic Chemistry... Popular Science - Cosmology - New Member Ingeniería en Español - Nuevo Miembro - New Member

Join Date: Feb 2005
Location: Albany, New York
Posts: 5060
Good Answers: 129
#15
In reply to #14

Re: The Chemistry of DNA Part 4

12/23/2009 11:02 AM

It's an excellent video. I actually reference it in the above blog. If you start from the 2:52 minute mark in the video and play it it covers what I discuss in this blog.

Reply
Guru
Hobbies - Fishing -

Join Date: Feb 2009
Location: Burnt Ranch, State of Jefferson
Posts: 688
Good Answers: 20
#16
In reply to #15

Re: The Chemistry of DNA Part 4

12/23/2009 11:09 AM

Oh, hey, yes you do. Missed that link. After reading your blog I wanted to find some good visuals on the subject... must not be too many good vids out there on the subject.

__________________
“Sometimes I wonder whether the world is being run by smart people who are putting us on or by imbeciles who really mean it.” -Mark Twain
Reply
The Engineer
Engineering Fields - Engineering Physics - Physics... United States - Member - NY Popular Science - Genetics - Organic Chemistry... Popular Science - Cosmology - New Member Ingeniería en Español - Nuevo Miembro - New Member

Join Date: Feb 2005
Location: Albany, New York
Posts: 5060
Good Answers: 129
#17
In reply to #16

Re: The Chemistry of DNA Part 4

12/23/2009 11:13 AM

There may be more, but I was so impressed by that video I didn't want to take away from it by posting other videos around it. Really is a terrific clip. Not too long, but gives you tons of info in a clear concise way. I'm glad it was mentioned again in the comments since I think more people will catch it and watch it.

Reply
Reply to Blog Entry 17 comments
Copy to Clipboard

Users who posted comments:

Anonymous Hero (2); april05 (2); Bayes (8); Jorrie (2); lighthasmass (2); TeslaFan (1)

Previous in Blog: The Chemistry of DNA, Part 3   Next in Blog: The Antiscience - Part I
You might be interested in: DNA Synthesizers, DNA Sequencers, Video Switchers

Advertisement