|

This is the fourth and final post in a series detailing the chemistry of DNA. In the previous post, I described how the human body mostly consists of proteins and water. I then described how proteins generally are crosslinked peptides, which are themselves made up of chained together (through peptide bonds) amino acids. In posts one and two of this series I described the chemical structure of DNA, explained what a gene and chromosome is, and showed how the size of DNA can vary from species to species. Now I want to tie it all together and explain DNA's role in the creation of proteins in the human body.
Simply put, proteins are the point of DNA. I've mentioned several times earlier that proteins are simply strings of amino acids. Each protein has a different combination (order) of amino acids that give it it's properties. That order, the order of the amino acids in the proteins, is encoded in DNA. DNA is a repository where all the amino acid sequences needed to make the proteins that make us human are stored. DNA knows how to make the proteins, the proteins make us.
DNA Code
DNA is a list of proteins encoded with nucleobases. Remember, in the earlier posts I told you that DNA consisted of two intertwined polymers with phosphate/sugar backbones that crosslinked with each other in a double helix pattern through pairs of complementary nucleobases. Those complementary nucleobases are Cystosine and Guanine, Thymine and Adenine. Those pairs appear like steps on a spiral staircase. Generally you read the nucleobases from one of the strands and you get the code. It will appear something like this:
GGGCTAAATGTATATTTTTAA
The G,C,T,A stand for Guanine, Cytosine, Thymine, and Adenine respectively.
In cells, that code above is transcribed by mRNA (Messenger RNA) by numerous processes to create Proteins.


Notice in the diagram to the right that the transcripted DNA code is read in threes. Each set of three nucleobases (called codons) represents a particular amino acid (represented by shapes). Those amino acids are put together to form the protein encoded by the DNA code. Now the diagram to the right is an incredible oversimplification, there are thousands of proteins and chemicals involved in this process, later in the blog we'll get into it a little bit more, but first.....
You may have noticed, or will notice soon, that RNA doesn't have the nucleobase Thymine. It instead has Uracil. The two bases are very similiar (see below):

So Uracil takes the place of Thymine when mRNA transcribes the DNA codon. Actually, if we are completely accurate here, the mRNA is actually a negative of the DNA code. For instance, if the DNA code is the following:
GGGCTAAATGTATATTTTTAA
where G,C,T,A are Guanine, Cytosine, Thymine, and Adanine respectively, then the transcribed mRNA sequence corresponding to the above would be:
CCCGAUUUACAUAUAAAAAUU
The mRNA sequence above is the complementary base pair sequence of the original DNA sequence, except Uracil is now the complimentary base pair of Adanine rather than Thymine. The mRNA is like the negative of a photograph, the inverse of the DNA sequence.
RNA to Amino Acid Decoding Table
We all know that for any good code you need a decoder ring. So here is you're super codon to amino acid decoder table (see below):

You can see in the above table that all 20 amino acids have at least one codon associated with them. Some have several, it's not a one to one relation, there are degeneracies. When mRNA transcribes DNA, it carries the codon information with it. The stop listed above in the table is the sequence of code that says the protein is completed.
DNA, mRNA, tRNA (oh my!)
So how does it happen? How does DNA code get turned into proteins? Well, a lot is involved, but the major players are DNA, messenger RNA (mRNA), and transfer RNA (tRNA). Here's a rough explanation of how it happens.
Step 1 - DNA and mRNA (Transcription)
As you know, DNA is two strands held together by nucleobase hydrogen bonds (see part one). Well the very first step is the breaking of these hydrogen bonds in a certain section of the DNA. Which section? That's complicated. Lets just say the section to be transcribed (or you can find an overview here). When these hydrogen bonds break, the a complementary messenger RNA (mRNA) strand is generated from the exposed single strand DNA in a process called transcription (see below):


Once the mRNA has been transcribed and processed a bit (overview here), it moves out of the cell nucleus (where the DNA is) and to a ribosome and begins the translation process.
Step 2 - mRNA, Ribosomes, tRNA (Translation)
Here's a few diagrams of the translation process:


There are many proteins and molecules involved in this process and the diagrams above are just the basics. Basically something called Transfer RNA (tRNA) attaches to the codons in mRNA. The tRNA has a portion called the "anticodon" which consists of the complimentary base pairs that correspond to a three nucleobase sequence (codon) of the mRNA sequence. A characteristic amino acid is attached to the other end of the tRNA. I say characteristic because the amino acid attached to that tRNA depends on the anticodon sequence on the other side. This is why the codons from mRNA control the order by which amino acids are put together.
Step 3 - Repeat

Cells are constantly generating proteins at different locations at all times. In a very basic sense, it's what it means to be alive. At this point I recommend watching from minute 2:51 till minute 6:54 in the following Youtube clip on DNA Translation and Transcription, it summarizes and expands many topics I discussed in this 4 part blog series.
So what does it all mean?
The Earth is 4.57 billion years old. The earliest evidence of life is debated but is somewhere in the range of 3.6 to 4.0 billion years ago. The truth is, it probably started before that (it's just hard to find the evidence). From a geological standpoint, life appeared shortly after the Earth did. What that means is if you have the conditions you have on Earth, life is likely. Evidence of multicellular life first appears 500 to 800 million years ago, meaning that it took roughly 3 billion years of cellular evolution to reach the point where multicellularism became possible. In less than a billion years we've evolved into complex organisms involving trillions of cells.
We all marvel at the complexity of our bodies. Hearts, brains, lungs, etc. working in unison seem miracles, and for some this is the only explanation. But wondering at such things is like reading the last chapter of a good novel. Most of the plot, most of the story is found in the processes found in our cells. Cells are unbelieveably complicated organic machines, streamlined over billions of years through fortuitous accidents. In the story of evolution, the protagonist is the cell. Multicelled organisms like ourselves are simply the most recent developement in the evolution of cellular symbiosis processess that evolved over eons.
So cells are the organic machines that is life, but they never could have evolved to such complexity if there wasn't a central molecule from which all the cell's processes ultimately are recorded, transcribed and translated. DNA does this astonishingly well. In a way, life can be viewed as a runaway chemical reaction. Soon after the Earth was born, the process of life started, and Earth has been stuck with life ever since (despite some truly respectable efforts to eradicate it). What DNA is, in the final evaluation, in my opinion, is an extremely robust catalyst that enables life.
Special Thanks to the Following Websites:
www.wikipedia.com
www.youtube.com
http://publications.nigms.nih.gov/thenewgenetics/chapter1.html
http://www.bio.miami.edu/~cmallery/150/gene/mol_gen.htm
|